Hi everyone, how can you read a file so it creates an object depending on the letter (its for a DNA game)
AATTAGCCGATACGATATCGATCGGCAGCAT
So when it is A, create an A object
I want it so it reads the line
I hope this makes sense
Printable View
Hi everyone, how can you read a file so it creates an object depending on the letter (its for a DNA game)
AATTAGCCGATACGATATCGATCGGCAGCAT
So when it is A, create an A object
I want it so it reads the line
I hope this makes sense
Start loop "Create" for Length(String) times
On loop "Create"
+ Mid(String,LoopIndex("Create"),1) = "A"
Create object A
On loop "Create"
+ Mid(String,LoopIndex("Create"),1) = "T"
Create object T
On loop "Create"
+ Mid(String,LoopIndex("Create"),1) = "G"
Create object G
And so on.
Jamie, I only have one thing to say to you, ONE THING :Mad:
I "worship" you
Thanks :) ;)
How do i do a loop?
Under the Special Object -> Fast loops -> Start loop
Also, how would you make the create thing because it keeps saying syntax error?
aka, how do i go the Mid(String,LoopIndex("Create"),1) = "A"
Use compare two general values under the special object and enter:
Mid$(<string>,LoopIndex("Create"),1)
and
"A"
Remember to replace <string> with the actual string.
the create thing is the name of the loop ;)
Here is a quick example... :blush:
www.skiosk-esd.com/clickteam/MMF2_examples/DNA.mfa
(right click - save as)
Hey, I did not ask for your help, ONLY JOKING :)
THANKS A MILLION
Rob