Hi everyone, DNA game HELP

Hi everyone, how can you read a file so it creates an object depending on the letter (its for a DNA game)

AATTAGCCGATACGATATCGATCGGCAGCAT

So when it is A, create an A object

I want it so it reads the line

I hope this makes sense

Start loop "Create" for Length(String) times

On loop "Create"
+ Mid(String,LoopIndex("Create"),1) = "A"
Create object A

On loop "Create"
+ Mid(String,LoopIndex("Create"),1) = "T"
Create object T

On loop "Create"
+ Mid(String,LoopIndex("Create"),1) = "G"
Create object G

And so on.

Jamie, I only have one thing to say to you, ONE THING :Mad:

I "worship" you

Thanks :) ;)

How do i do a loop?

Under the Special Object -> Fast loops -> Start loop

Also, how would you make the create thing because it keeps saying syntax error?

aka, how do i go the Mid(String,LoopIndex("Create"),1) = "A"

Use compare two general values under the special object and enter:
Mid$(<string>,LoopIndex("Create"),1)
and
"A"

Remember to replace <string> with the actual string.

the create thing is the name of the loop ;)

Here is a quick example... :blush:

www.skiosk-esd.com/clickteam/MMF2_examples/DNA.mfa
(right click - save as)

Hey, I did not ask for your help, ONLY JOKING :)

THANKS A MILLION

Rob